Single Cell:Article Title: Circulating natural killer cells are phenotypically and functionally altered in age-related macular degeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Single-cell transcriptomics of the human retinal pigment epithelium and choroid in health and macular degeneration (human) Voigt AP et al., 2019 GEO: GSE135922 Experimental models: Cell lines Human: Human Retinal Microvascular Endothelial Cells Cell Systems Cat# ACBRI 181 Human: NK-92MI ATCC Cat# CRL-2408; RRID:CVCL_3755 Human: LCL 721.221 Merck RRID: CVCL_6263 Experimental models: Organisms/strains C57Bl/6J The Jackson Laboratory RRID:IMSR_JAX:000664 NCR1-GFP Mice Eckelhart et al., 2011 JR5558 Mice The Jackson Laboratory RRID:IMSR_JAX:005558 Oligonucleotides For Primer Sequences for qPCR Analysis, See Methods & Figure S7A Software and algorithms ImageJ/Fiji NIH https://imagej.nih.gov/ij GraphPad Prism GraphPad https://www.graphpad.com LasX microscope analysis software Leica https://www.leica-microsystems.com/products/ microscope-software/p/leica-las-x-ls/downloads/ Incucyte analysis 2024B Sartorius https://downloads.essenbioscience.com/get/ incucyte-2022b-rev2-gui FlowJoTM v10.8–10 Software BD https://www.flowjo.com/flowjo10/download Cell Ranger Single-Cell Software Suite v5.0 10x Genomics https://www.10xgenomics.com/support/software/ cell-ranger/downloads Scanpy – Single-Cell Analysis in Python Github https://github.com/scverse/scanpy/tree/main Scrublet Github https://github.com/swolock/scrublet Scanorama Github https://github.com/brianhie/scanorama R Statistical Software v4.3.1 R Core Team https://www.r-project.org/ e3 Cell Reports Medicine 7, 102792, June 16, 2026 Article ll OPEN ACCESS ..
Transcriptomics:Article Title: Circulating natural killer cells are phenotypically and functionally altered in age-related macular degeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Single-cell transcriptomics of the human retinal pigment epithelium and choroid in health and macular degeneration (human) Voigt AP et al., 2019 GEO: GSE135922 Experimental models: Cell lines Human: Human Retinal Microvascular Endothelial Cells Cell Systems Cat# ACBRI 181 Human: NK-92MI ATCC Cat# CRL-2408; RRID:CVCL_3755 Human: LCL 721.221 Merck RRID: CVCL_6263 Experimental models: Organisms/strains C57Bl/6J The Jackson Laboratory RRID:IMSR_JAX:000664 NCR1-GFP Mice Eckelhart et al., 2011 JR5558 Mice The Jackson Laboratory RRID:IMSR_JAX:005558 Oligonucleotides For Primer Sequences for qPCR Analysis, See Methods & Figure S7A Software and algorithms ImageJ/Fiji NIH https://imagej.nih.gov/ij GraphPad Prism GraphPad https://www.graphpad.com LasX microscope analysis software Leica https://www.leica-microsystems.com/products/ microscope-software/p/leica-las-x-ls/downloads/ Incucyte analysis 2024B Sartorius https://downloads.essenbioscience.com/get/ incucyte-2022b-rev2-gui FlowJoTM v10.8–10 Software BD https://www.flowjo.com/flowjo10/download Cell Ranger Single-Cell Software Suite v5.0 10x Genomics https://www.10xgenomics.com/support/software/ cell-ranger/downloads Scanpy – Single-Cell Analysis in Python Github https://github.com/scverse/scanpy/tree/main Scrublet Github https://github.com/swolock/scrublet Scanorama Github https://github.com/brianhie/scanorama R Statistical Software v4.3.1 R Core Team https://www.r-project.org/ e3 Cell Reports Medicine 7, 102792, June 16, 2026 Article ll OPEN ACCESS ..
Mouse Assay:Article Title: Circulating natural killer cells are phenotypically and functionally altered in age-related macular degeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Single-cell transcriptomics of the human retinal pigment epithelium and choroid in health and macular degeneration (human) Voigt AP et al., 2019 GEO: GSE135922 Experimental models: Cell lines Human: Human Retinal Microvascular Endothelial Cells Cell Systems Cat# ACBRI 181 Human: NK-92MI ATCC Cat# CRL-2408; RRID:CVCL_3755 Human: LCL 721.221 Merck RRID: CVCL_6263 Experimental models: Organisms/strains C57Bl/6J The Jackson Laboratory RRID:IMSR_JAX:000664 NCR1-GFP Mice Eckelhart et al., 2011 JR5558 Mice The Jackson Laboratory RRID:IMSR_JAX:005558 Oligonucleotides For Primer Sequences for qPCR Analysis, See Methods & Figure S7A Software and algorithms ImageJ/Fiji NIH https://imagej.nih.gov/ij GraphPad Prism GraphPad https://www.graphpad.com LasX microscope analysis software Leica https://www.leica-microsystems.com/products/ microscope-software/p/leica-las-x-ls/downloads/ Incucyte analysis 2024B Sartorius https://downloads.essenbioscience.com/get/ incucyte-2022b-rev2-gui FlowJoTM v10.8–10 Software BD https://www.flowjo.com/flowjo10/download Cell Ranger Single-Cell Software Suite v5.0 10x Genomics https://www.10xgenomics.com/support/software/ cell-ranger/downloads Scanpy – Single-Cell Analysis in Python Github https://github.com/scverse/scanpy/tree/main Scrublet Github https://github.com/swolock/scrublet Scanorama Github https://github.com/brianhie/scanorama R Statistical Software v4.3.1 R Core Team https://www.r-project.org/ e3 Cell Reports Medicine 7, 102792, June 16, 2026 Article ll OPEN ACCESS ..
Article Title: Prefrontal gamma oscillations engage dynamic cell-type-specific configurations to support flexible behavior.
Article Snippet: .. For experiments REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-GFP primary polyclonal antibody Invitrogen A-11122; RRID: AB_221569 Goat anti-Rabbit IgG (H+L) Alexa Fuor 647 Invitrogen A21245; RRID: AB_2535813 Bacterial and virus strains pAAV-nEF-Coff/Fon-NpHR3.3-EYFP Fenno et al.43 RRID: Addgene_137154 AAV8-nEF-Coff/Fon-NpHR3.3-BFP Virovek N/A AAV1-CAG-DIO-Ace2N-4AA-mNeon Virovek (Plasmid provided by Mark J Schnitzer– Stanford) N/A AAV2/PHP.eB-Ef1a-fDIO-AcemNeon2-WPRE This paper; Provided by Mark J. Schitzer – Stanford N/A AAV2/PHP.eB-Ef1a-DIO-Varnam2-WPRE Haziza et al.30 RRID: Addgene_240055 AAV2/PHP.eB-CAG-cyOFP Haziza et al.30 RRID: Addgene_240050 CAV2-Cre Plateforme de Vectorologie de Montpellier CAV CRE Experimental models: Organisms/strains C57Bl/6J Mice The Jackson Laboratory RRID: IMSR_JAX:000664 Ai14 Mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre Mice The Jackson Laboratory RRID: IMSR_JAX:017320 PV-Flp Mice The Jackson Laboratory RRID: IMSR_JAX:022730 Software and algorithms MATLAB Mathworks RRID: SCR_001622 Graphpad Prism Graphpad RRID: SCR_002798 Synapse – Neurophysiology Suite Tucker-Davis Technologies N/A Video Scoring Software This Paper 10.5281/zenodo.19893431 Behavioral Classification Software This Paper 10.5281/zenodo.19893431 Analysis Software This Paper 10.5281/zenodo.19893431 ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e6, October 21, 2026 combining GEVI expression in PFC-MD neurons with fDIO-NpHR3.0-BFP expression in prefrontal PVI, animals of the PV-Flp (Jax; 022730) line were crossed with Ai14 to generate PV-Flp+/-/Ai14+/- mice enabling expression of Ace-mNeon and TdTomato in PFC-MD neurons and NpHR3.0-BFP in prefrontal PVI (Figure 4). ..
Real-time Polymerase Chain Reaction:Article Title: Circulating natural killer cells are phenotypically and functionally altered in age-related macular degeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Single-cell transcriptomics of the human retinal pigment epithelium and choroid in health and macular degeneration (human) Voigt AP et al., 2019 GEO: GSE135922 Experimental models: Cell lines Human: Human Retinal Microvascular Endothelial Cells Cell Systems Cat# ACBRI 181 Human: NK-92MI ATCC Cat# CRL-2408; RRID:CVCL_3755 Human: LCL 721.221 Merck RRID: CVCL_6263 Experimental models: Organisms/strains C57Bl/6J The Jackson Laboratory RRID:IMSR_JAX:000664 NCR1-GFP Mice Eckelhart et al., 2011 JR5558 Mice The Jackson Laboratory RRID:IMSR_JAX:005558 Oligonucleotides For Primer Sequences for qPCR Analysis, See Methods & Figure S7A Software and algorithms ImageJ/Fiji NIH https://imagej.nih.gov/ij GraphPad Prism GraphPad https://www.graphpad.com LasX microscope analysis software Leica https://www.leica-microsystems.com/products/ microscope-software/p/leica-las-x-ls/downloads/ Incucyte analysis 2024B Sartorius https://downloads.essenbioscience.com/get/ incucyte-2022b-rev2-gui FlowJoTM v10.8–10 Software BD https://www.flowjo.com/flowjo10/download Cell Ranger Single-Cell Software Suite v5.0 10x Genomics https://www.10xgenomics.com/support/software/ cell-ranger/downloads Scanpy – Single-Cell Analysis in Python Github https://github.com/scverse/scanpy/tree/main Scrublet Github https://github.com/swolock/scrublet Scanorama Github https://github.com/brianhie/scanorama R Statistical Software v4.3.1 R Core Team https://www.r-project.org/ e3 Cell Reports Medicine 7, 102792, June 16, 2026 Article ll OPEN ACCESS ..
Software:Article Title: Circulating natural killer cells are phenotypically and functionally altered in age-related macular degeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Single-cell transcriptomics of the human retinal pigment epithelium and choroid in health and macular degeneration (human) Voigt AP et al., 2019 GEO: GSE135922 Experimental models: Cell lines Human: Human Retinal Microvascular Endothelial Cells Cell Systems Cat# ACBRI 181 Human: NK-92MI ATCC Cat# CRL-2408; RRID:CVCL_3755 Human: LCL 721.221 Merck RRID: CVCL_6263 Experimental models: Organisms/strains C57Bl/6J The Jackson Laboratory RRID:IMSR_JAX:000664 NCR1-GFP Mice Eckelhart et al., 2011 JR5558 Mice The Jackson Laboratory RRID:IMSR_JAX:005558 Oligonucleotides For Primer Sequences for qPCR Analysis, See Methods & Figure S7A Software and algorithms ImageJ/Fiji NIH https://imagej.nih.gov/ij GraphPad Prism GraphPad https://www.graphpad.com LasX microscope analysis software Leica https://www.leica-microsystems.com/products/ microscope-software/p/leica-las-x-ls/downloads/ Incucyte analysis 2024B Sartorius https://downloads.essenbioscience.com/get/ incucyte-2022b-rev2-gui FlowJoTM v10.8–10 Software BD https://www.flowjo.com/flowjo10/download Cell Ranger Single-Cell Software Suite v5.0 10x Genomics https://www.10xgenomics.com/support/software/ cell-ranger/downloads Scanpy – Single-Cell Analysis in Python Github https://github.com/scverse/scanpy/tree/main Scrublet Github https://github.com/swolock/scrublet Scanorama Github https://github.com/brianhie/scanorama R Statistical Software v4.3.1 R Core Team https://www.r-project.org/ e3 Cell Reports Medicine 7, 102792, June 16, 2026 Article ll OPEN ACCESS ..
Article Title: Tissue-specific tolerance mechanisms and lymph node co-drainage shape T cell immunity in the upper digestive system and pancreatic cancer progression.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 0.05% Trypsin/0.53mM EDTA in HBSS Corning Cat#25-051-CI Ampicillin sodium salt Thermo Fisher Cat#BP176025 Puromycin Ready Made Solution Millipore Sigma Cat#P4512-1MLX10 Dapi Fluoromount G Clear Mounting Media Thermo Fisher Cat#OB010020 2-mercaptoethanol Sigma Aldrich Cat#M7522 RPMI 1640, powder Thermo Fisher Cat#31800105 Percoll GE Healthcare Cat#17089109 HEPES Buffer Corning Cat#25060CI LIVE/DEADTM Fixable Near-IR Thermo Fisher Cat#L10119 Zombie NIRTM Biolegend Cat#423105 CellTraceTM CFSE Thermo Fisher Cat#C34554 Meloxicam Injection, 5 mg/mL, Solution for Injection Covetrus Cat#049755 Buprenorphine in Polymer Injection Solution 0.5 mg/mL Wedgewood Pharmacy Cat# BUPREN-INJ010VC PE-conjugated H2-Kb chicken ova 257–264 SIINFEKL NIH Tetramer Core Facility N/A APC-conjugated H2-Kb chicken ova 257–264 SIINFEKL NIH Tetramer Core Facility N/A PE-conjugated I-Ab chicken ova 328–337 HAAHAEINEA NIH Tetramer Core Facility N/A APC-conjugated I-Ab chicken ova 328–337 HAAHAEINEA NIH Tetramer Core Facility N/A Trypan blue solution, 0.4% Thermo Fisher Cat#15250061 Buffer TCL Qiagen Cat#1031576 Critical commercial assays Fixation/permeabilization Concentrate Thermo Fisher Cat#00-5123-43 Fixation/permeabilization Diluent Thermo Fisher Cat#00-5223-56 Cytofix/cytopermTM Fixation and Permeabilization Solution BD Biosciences Cat#554722 Permeabilization Buffer (10X) Thermo Fisher Cat#00-8333-56 GolgiPlugTM Protein Transport Inhibitor BD Biosciences Cat#555029 eBioscienceTM Cell Stimulation Cocktail Thermo Fisher Cat#00-4975-93 SuperScriptTM III One-Step RT-PCR System with PlatinumTM Taq High Fidelity DNA Polymerase Thermo Fisher Cat#12574035 Maxima H Minus Reverse Transcriptase (200 U/μL) Thermo Fisher Cat#EP0753 RNasinTM Plus RNase Inhibitor Promega Cat#N2611 HiFi HS Ready Mix 2X KAPA Biosystems Cat#K2601K EasySep Mouse T cell Isolation Kit Stemcell Technologies Cat#19851 ApopTag Fluorescein In Situ Apoptosis Detection Kit EMD Millipore Cat#S7110 Anti-biotin Microbeads Miltenyi Biotec Cat#130090485 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Clarity Max Western ECL Substrate Bio-Rad Cat#1705062 QIAprep Spin Miniprep Kit (50) Qiagen Cat#27104 QIAquick Gel Extraction Kit (50) Qiagen Cat#28704 Lipofectamine 3000 Transfection Reagent Thermo Fisher Cat#L3000008 Experimental models: Organisms/strains Mouse: C57BL/6J (B6) Jackson Laboratory RRID: IMSR_JAX:000664 (Continued on next page) 20 Cell Reports 45, 117324, May 26, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6.Cg-Tg(TcraTcrb)425Cbn/J (OT-II) Mucida Lab (Rockefeller University) RRID: IMSR_JAX:004194 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J (OT-I) Jackson Laboratory RRID: IMSR_JAX:003831 Mouse: B6.SJL-Ptprca Pepcb/BoyJ (CD45.1) Jackson Laboratory RRID: IMSR_JAX:033076 Mouse: B6.129S6(Cg)-Ptf1atm2(cre/ESR1)Cvw/J (Ptf1aCreERT2) Jackson Laboratory RRID: IMSR_JAX:036577 Mouse: B6(Cg)-Ins1tm2.1(cre/ERT2)Thor/J (Ins1CreERT2) Jackson Laboratory RRID: IMSR_JAX:026802 Mouse: B6.Cg-Tg(Vil1-cre/ERT2)23Syr/J (VillinCreERT2) Jackson Laboratory RRID: IMSR_JAX:020282 Mouse: B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J (AlbCre) Jackson Laboratory RRID: IMSR_JAX:003574 Mouse: B6.129S2-Albtm1(cre/ERT2)Mtz/J (AlbCreERT2) Mahan Lab (UT Health Houston) RRID: IMSR_JAX:039060 Mouse: Rosa26-sOVA Zhou et al.7 N/A Mouse: Rosa26-cOVA Zhou et al.7 N/A Mouse: Rosa26-tmOVA Zhou et al.7 N/A Cell line: KPC58 Muir Lab (University of Chicago) N/A Cell line: HEK293T ATCC Cat#CRL-3216 Cell line: L cell, L929 ATCC Cat#CCL-1 Oligonucleotides OVA_F Integrated DNA Technologies CTTCAAAGGACTGTGGGAGAAA OVA_R Integrated DNA Technologies CTCCATCTTCATGCGAGGTAAG pLJM1_sOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTCAGATCC GATGGGCTCCATCGGTGCAG pLJM1_sOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTA CCCGGTAGCGTTACTTGTCATC GTCATCCTTGTAATC pLJM1_cOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTCAGATCCG ATGGGCTCCATCGGCGCAG pLJM1_cOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTACC CGGTAGCGTTACTTGTCATCGTCATCCTTGTAATCG pLJM1_tmOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTC AGATCCGATGATGGATCAAGCTAGATCAG pLJM1_tmOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTAC CCGGTAGCGTTACTTGTCATCGTCATCCTTG Software and algorithms GraphPad Prism (v10.6.1) GraphPad https://www.graphpad.com/ FlowJo (v10.10.0) Tree Star https://www.flowjo.com/ QuPath (v0.5.1) Bankhead et al.33 https://qupath.github.io/ Adobe Illustrator (v29.0) Adobe www.adobe.com/products/illustrator Devices BD LSRII BD Biosciences N/A 5-laser Aurora spectral flow cytometer Cytek Bioscience N/A EVOSTM FL fluorescent microscope Invitrogen N/A SP8 confocal microscope Leica N/A Cell Reports 45, 117324, May 26, 2026 21 (B6.129S6(Cg)-Ptf1atm2(cre/ESR1)Cvw/J), Ins1CRE-ERT2 (B6(Cg)-Ins1tm2.1(cre/ERT2)Thor/J), OT-I (C57BL/6-Tg(TcraTcrb) 1100Mjb/J), OT-II (B6.Cg-Tg(TcraTcrb)425Cbn/J), AlbCre (B6.Cg-Speer6-ps1Tg(Alb-cre)21 Mgn/J), p53LOXP (B6.129P2-Trp53tm1Brn/J) and KrasFSF−G12D (B6(Cg)-Krastm5Tyj/J) were purchased from The Jackson Laboratory. ..
Article Title: Prefrontal gamma oscillations engage dynamic cell-type-specific configurations to support flexible behavior.
Article Snippet: .. For experiments REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-GFP primary polyclonal antibody Invitrogen A-11122; RRID: AB_221569 Goat anti-Rabbit IgG (H+L) Alexa Fuor 647 Invitrogen A21245; RRID: AB_2535813 Bacterial and virus strains pAAV-nEF-Coff/Fon-NpHR3.3-EYFP Fenno et al.43 RRID: Addgene_137154 AAV8-nEF-Coff/Fon-NpHR3.3-BFP Virovek N/A AAV1-CAG-DIO-Ace2N-4AA-mNeon Virovek (Plasmid provided by Mark J Schnitzer– Stanford) N/A AAV2/PHP.eB-Ef1a-fDIO-AcemNeon2-WPRE This paper; Provided by Mark J. Schitzer – Stanford N/A AAV2/PHP.eB-Ef1a-DIO-Varnam2-WPRE Haziza et al.30 RRID: Addgene_240055 AAV2/PHP.eB-CAG-cyOFP Haziza et al.30 RRID: Addgene_240050 CAV2-Cre Plateforme de Vectorologie de Montpellier CAV CRE Experimental models: Organisms/strains C57Bl/6J Mice The Jackson Laboratory RRID: IMSR_JAX:000664 Ai14 Mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre Mice The Jackson Laboratory RRID: IMSR_JAX:017320 PV-Flp Mice The Jackson Laboratory RRID: IMSR_JAX:022730 Software and algorithms MATLAB Mathworks RRID: SCR_001622 Graphpad Prism Graphpad RRID: SCR_002798 Synapse – Neurophysiology Suite Tucker-Davis Technologies N/A Video Scoring Software This Paper 10.5281/zenodo.19893431 Behavioral Classification Software This Paper 10.5281/zenodo.19893431 Analysis Software This Paper 10.5281/zenodo.19893431 ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e6, October 21, 2026 combining GEVI expression in PFC-MD neurons with fDIO-NpHR3.0-BFP expression in prefrontal PVI, animals of the PV-Flp (Jax; 022730) line were crossed with Ai14 to generate PV-Flp+/-/Ai14+/- mice enabling expression of Ace-mNeon and TdTomato in PFC-MD neurons and NpHR3.0-BFP in prefrontal PVI (Figure 4). ..
Article Title: Synaptic plasticity of prefrontal long-range inhibition regulates cognitive flexibility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains PV-Cre mice The Jackson Laboratory RRID: IMSR_JAX:008069 Ai14 mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre:Ai14 mice In-house Derived from 008069 and 007914 Bacterial and virus strains AAV5:EF1a:DIO:hChR2(H134R)-EYFPWPRE-pA University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:eNpHR3.0-mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAVrg-CAG-tdTomato Addgene 59462-AAVrg AAVrg-DIO-eYFP Addgene 27056-AAVrg Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (CTb)-Alexa Fluor 594 Invitrogen Cat#C34777 Cholera toxin subunit B (CTb)-Alexa Fluor 488 Invitrogen Cat#C34775 CNQX Tocris Cat#0190 Gabazine Tocris Cat#1262 D-AP5 Tocris Cat#0106 QX-314 bromide Tocris Cat#1014 Software and algorithms pCLAMP 11 Molecular Devices https://www.moleculardevices.com/products/ axon-patch-clamp-system/acquisition-andanalysis-software/pclamp-software-suite Prism 10 GraphPad https://www.graphpad.com SimplyFire 0.6.1 Mori et al.57 N/A Other 10 μL Nanofil syringe World Precision Instruments Cat#NANOFIL Syringe pump World Precision Instruments Cat#UMP3 Vibratome Leica Microsystems VT1200S Digidata 1440A Digitizer Molecular Devices N/A Multiclamp 700A amplifier Molecular Devices N/A Borosilicate glass pipettes Sutter Instruments Cat#FGGBF1007810 IR-DIC microscope (BX51WI) Olympus Cat#BX51WI LED light source Sutter Instrument Lambda FLED 530 LED light source Sutter Instrument Lambda FLED 480 473 nm laser OEM Laser Systems Cat#BL-473-00050-CWM-SD-03-LED-0 594 nm laser (Cobolt 04-01 Series) HÜBNER Photonics N/A Function generator Agilent Cat#33500B Mono fiber-optic implant Doric Lenses Cat#MFC_200/240-0.22_2.0mm_FLT Fiber-optic patch cord Doric Lenses Cat#MFP_200/220/ LWMJ-0.22_2m_FC- FC Small animal food bowls (Nibble Bowls) Pet Smart N/A Light meter ThorLabs Cat#PM100D Metabond Quick Adhesive Cement Parkell Cat#S380 Food pellets (20 mg) Bio-Serv Cat#F0163 (Continued on next page) ll OPEN ACCESS Report e1 Neuron 114, 1–11.e1–e4, October 7, 2026 ..
Microscopy:Article Title: Circulating natural killer cells are phenotypically and functionally altered in age-related macular degeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Single-cell transcriptomics of the human retinal pigment epithelium and choroid in health and macular degeneration (human) Voigt AP et al., 2019 GEO: GSE135922 Experimental models: Cell lines Human: Human Retinal Microvascular Endothelial Cells Cell Systems Cat# ACBRI 181 Human: NK-92MI ATCC Cat# CRL-2408; RRID:CVCL_3755 Human: LCL 721.221 Merck RRID: CVCL_6263 Experimental models: Organisms/strains C57Bl/6J The Jackson Laboratory RRID:IMSR_JAX:000664 NCR1-GFP Mice Eckelhart et al., 2011 JR5558 Mice The Jackson Laboratory RRID:IMSR_JAX:005558 Oligonucleotides For Primer Sequences for qPCR Analysis, See Methods & Figure S7A Software and algorithms ImageJ/Fiji NIH https://imagej.nih.gov/ij GraphPad Prism GraphPad https://www.graphpad.com LasX microscope analysis software Leica https://www.leica-microsystems.com/products/ microscope-software/p/leica-las-x-ls/downloads/ Incucyte analysis 2024B Sartorius https://downloads.essenbioscience.com/get/ incucyte-2022b-rev2-gui FlowJoTM v10.8–10 Software BD https://www.flowjo.com/flowjo10/download Cell Ranger Single-Cell Software Suite v5.0 10x Genomics https://www.10xgenomics.com/support/software/ cell-ranger/downloads Scanpy – Single-Cell Analysis in Python Github https://github.com/scverse/scanpy/tree/main Scrublet Github https://github.com/swolock/scrublet Scanorama Github https://github.com/brianhie/scanorama R Statistical Software v4.3.1 R Core Team https://www.r-project.org/ e3 Cell Reports Medicine 7, 102792, June 16, 2026 Article ll OPEN ACCESS ..
Article Title: Tissue-specific tolerance mechanisms and lymph node co-drainage shape T cell immunity in the upper digestive system and pancreatic cancer progression.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 0.05% Trypsin/0.53mM EDTA in HBSS Corning Cat#25-051-CI Ampicillin sodium salt Thermo Fisher Cat#BP176025 Puromycin Ready Made Solution Millipore Sigma Cat#P4512-1MLX10 Dapi Fluoromount G Clear Mounting Media Thermo Fisher Cat#OB010020 2-mercaptoethanol Sigma Aldrich Cat#M7522 RPMI 1640, powder Thermo Fisher Cat#31800105 Percoll GE Healthcare Cat#17089109 HEPES Buffer Corning Cat#25060CI LIVE/DEADTM Fixable Near-IR Thermo Fisher Cat#L10119 Zombie NIRTM Biolegend Cat#423105 CellTraceTM CFSE Thermo Fisher Cat#C34554 Meloxicam Injection, 5 mg/mL, Solution for Injection Covetrus Cat#049755 Buprenorphine in Polymer Injection Solution 0.5 mg/mL Wedgewood Pharmacy Cat# BUPREN-INJ010VC PE-conjugated H2-Kb chicken ova 257–264 SIINFEKL NIH Tetramer Core Facility N/A APC-conjugated H2-Kb chicken ova 257–264 SIINFEKL NIH Tetramer Core Facility N/A PE-conjugated I-Ab chicken ova 328–337 HAAHAEINEA NIH Tetramer Core Facility N/A APC-conjugated I-Ab chicken ova 328–337 HAAHAEINEA NIH Tetramer Core Facility N/A Trypan blue solution, 0.4% Thermo Fisher Cat#15250061 Buffer TCL Qiagen Cat#1031576 Critical commercial assays Fixation/permeabilization Concentrate Thermo Fisher Cat#00-5123-43 Fixation/permeabilization Diluent Thermo Fisher Cat#00-5223-56 Cytofix/cytopermTM Fixation and Permeabilization Solution BD Biosciences Cat#554722 Permeabilization Buffer (10X) Thermo Fisher Cat#00-8333-56 GolgiPlugTM Protein Transport Inhibitor BD Biosciences Cat#555029 eBioscienceTM Cell Stimulation Cocktail Thermo Fisher Cat#00-4975-93 SuperScriptTM III One-Step RT-PCR System with PlatinumTM Taq High Fidelity DNA Polymerase Thermo Fisher Cat#12574035 Maxima H Minus Reverse Transcriptase (200 U/μL) Thermo Fisher Cat#EP0753 RNasinTM Plus RNase Inhibitor Promega Cat#N2611 HiFi HS Ready Mix 2X KAPA Biosystems Cat#K2601K EasySep Mouse T cell Isolation Kit Stemcell Technologies Cat#19851 ApopTag Fluorescein In Situ Apoptosis Detection Kit EMD Millipore Cat#S7110 Anti-biotin Microbeads Miltenyi Biotec Cat#130090485 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Clarity Max Western ECL Substrate Bio-Rad Cat#1705062 QIAprep Spin Miniprep Kit (50) Qiagen Cat#27104 QIAquick Gel Extraction Kit (50) Qiagen Cat#28704 Lipofectamine 3000 Transfection Reagent Thermo Fisher Cat#L3000008 Experimental models: Organisms/strains Mouse: C57BL/6J (B6) Jackson Laboratory RRID: IMSR_JAX:000664 (Continued on next page) 20 Cell Reports 45, 117324, May 26, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6.Cg-Tg(TcraTcrb)425Cbn/J (OT-II) Mucida Lab (Rockefeller University) RRID: IMSR_JAX:004194 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J (OT-I) Jackson Laboratory RRID: IMSR_JAX:003831 Mouse: B6.SJL-Ptprca Pepcb/BoyJ (CD45.1) Jackson Laboratory RRID: IMSR_JAX:033076 Mouse: B6.129S6(Cg)-Ptf1atm2(cre/ESR1)Cvw/J (Ptf1aCreERT2) Jackson Laboratory RRID: IMSR_JAX:036577 Mouse: B6(Cg)-Ins1tm2.1(cre/ERT2)Thor/J (Ins1CreERT2) Jackson Laboratory RRID: IMSR_JAX:026802 Mouse: B6.Cg-Tg(Vil1-cre/ERT2)23Syr/J (VillinCreERT2) Jackson Laboratory RRID: IMSR_JAX:020282 Mouse: B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J (AlbCre) Jackson Laboratory RRID: IMSR_JAX:003574 Mouse: B6.129S2-Albtm1(cre/ERT2)Mtz/J (AlbCreERT2) Mahan Lab (UT Health Houston) RRID: IMSR_JAX:039060 Mouse: Rosa26-sOVA Zhou et al.7 N/A Mouse: Rosa26-cOVA Zhou et al.7 N/A Mouse: Rosa26-tmOVA Zhou et al.7 N/A Cell line: KPC58 Muir Lab (University of Chicago) N/A Cell line: HEK293T ATCC Cat#CRL-3216 Cell line: L cell, L929 ATCC Cat#CCL-1 Oligonucleotides OVA_F Integrated DNA Technologies CTTCAAAGGACTGTGGGAGAAA OVA_R Integrated DNA Technologies CTCCATCTTCATGCGAGGTAAG pLJM1_sOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTCAGATCC GATGGGCTCCATCGGTGCAG pLJM1_sOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTA CCCGGTAGCGTTACTTGTCATC GTCATCCTTGTAATC pLJM1_cOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTCAGATCCG ATGGGCTCCATCGGCGCAG pLJM1_cOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTACC CGGTAGCGTTACTTGTCATCGTCATCCTTGTAATCG pLJM1_tmOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTC AGATCCGATGATGGATCAAGCTAGATCAG pLJM1_tmOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTAC CCGGTAGCGTTACTTGTCATCGTCATCCTTG Software and algorithms GraphPad Prism (v10.6.1) GraphPad https://www.graphpad.com/ FlowJo (v10.10.0) Tree Star https://www.flowjo.com/ QuPath (v0.5.1) Bankhead et al.33 https://qupath.github.io/ Adobe Illustrator (v29.0) Adobe www.adobe.com/products/illustrator Devices BD LSRII BD Biosciences N/A 5-laser Aurora spectral flow cytometer Cytek Bioscience N/A EVOSTM FL fluorescent microscope Invitrogen N/A SP8 confocal microscope Leica N/A Cell Reports 45, 117324, May 26, 2026 21 (B6.129S6(Cg)-Ptf1atm2(cre/ESR1)Cvw/J), Ins1CRE-ERT2 (B6(Cg)-Ins1tm2.1(cre/ERT2)Thor/J), OT-I (C57BL/6-Tg(TcraTcrb) 1100Mjb/J), OT-II (B6.Cg-Tg(TcraTcrb)425Cbn/J), AlbCre (B6.Cg-Speer6-ps1Tg(Alb-cre)21 Mgn/J), p53LOXP (B6.129P2-Trp53tm1Brn/J) and KrasFSF−G12D (B6(Cg)-Krastm5Tyj/J) were purchased from The Jackson Laboratory. ..
Article Title: Synaptic plasticity of prefrontal long-range inhibition regulates cognitive flexibility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains PV-Cre mice The Jackson Laboratory RRID: IMSR_JAX:008069 Ai14 mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre:Ai14 mice In-house Derived from 008069 and 007914 Bacterial and virus strains AAV5:EF1a:DIO:hChR2(H134R)-EYFPWPRE-pA University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:eNpHR3.0-mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAVrg-CAG-tdTomato Addgene 59462-AAVrg AAVrg-DIO-eYFP Addgene 27056-AAVrg Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (CTb)-Alexa Fluor 594 Invitrogen Cat#C34777 Cholera toxin subunit B (CTb)-Alexa Fluor 488 Invitrogen Cat#C34775 CNQX Tocris Cat#0190 Gabazine Tocris Cat#1262 D-AP5 Tocris Cat#0106 QX-314 bromide Tocris Cat#1014 Software and algorithms pCLAMP 11 Molecular Devices https://www.moleculardevices.com/products/ axon-patch-clamp-system/acquisition-andanalysis-software/pclamp-software-suite Prism 10 GraphPad https://www.graphpad.com SimplyFire 0.6.1 Mori et al.57 N/A Other 10 μL Nanofil syringe World Precision Instruments Cat#NANOFIL Syringe pump World Precision Instruments Cat#UMP3 Vibratome Leica Microsystems VT1200S Digidata 1440A Digitizer Molecular Devices N/A Multiclamp 700A amplifier Molecular Devices N/A Borosilicate glass pipettes Sutter Instruments Cat#FGGBF1007810 IR-DIC microscope (BX51WI) Olympus Cat#BX51WI LED light source Sutter Instrument Lambda FLED 530 LED light source Sutter Instrument Lambda FLED 480 473 nm laser OEM Laser Systems Cat#BL-473-00050-CWM-SD-03-LED-0 594 nm laser (Cobolt 04-01 Series) HÜBNER Photonics N/A Function generator Agilent Cat#33500B Mono fiber-optic implant Doric Lenses Cat#MFC_200/240-0.22_2.0mm_FLT Fiber-optic patch cord Doric Lenses Cat#MFP_200/220/ LWMJ-0.22_2m_FC- FC Small animal food bowls (Nibble Bowls) Pet Smart N/A Light meter ThorLabs Cat#PM100D Metabond Quick Adhesive Cement Parkell Cat#S380 Food pellets (20 mg) Bio-Serv Cat#F0163 (Continued on next page) ll OPEN ACCESS Report e1 Neuron 114, 1–11.e1–e4, October 7, 2026 ..
Flow Cytometry:Article Title: Tissue-specific tolerance mechanisms and lymph node co-drainage shape T cell immunity in the upper digestive system and pancreatic cancer progression.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 0.05% Trypsin/0.53mM EDTA in HBSS Corning Cat#25-051-CI Ampicillin sodium salt Thermo Fisher Cat#BP176025 Puromycin Ready Made Solution Millipore Sigma Cat#P4512-1MLX10 Dapi Fluoromount G Clear Mounting Media Thermo Fisher Cat#OB010020 2-mercaptoethanol Sigma Aldrich Cat#M7522 RPMI 1640, powder Thermo Fisher Cat#31800105 Percoll GE Healthcare Cat#17089109 HEPES Buffer Corning Cat#25060CI LIVE/DEADTM Fixable Near-IR Thermo Fisher Cat#L10119 Zombie NIRTM Biolegend Cat#423105 CellTraceTM CFSE Thermo Fisher Cat#C34554 Meloxicam Injection, 5 mg/mL, Solution for Injection Covetrus Cat#049755 Buprenorphine in Polymer Injection Solution 0.5 mg/mL Wedgewood Pharmacy Cat# BUPREN-INJ010VC PE-conjugated H2-Kb chicken ova 257–264 SIINFEKL NIH Tetramer Core Facility N/A APC-conjugated H2-Kb chicken ova 257–264 SIINFEKL NIH Tetramer Core Facility N/A PE-conjugated I-Ab chicken ova 328–337 HAAHAEINEA NIH Tetramer Core Facility N/A APC-conjugated I-Ab chicken ova 328–337 HAAHAEINEA NIH Tetramer Core Facility N/A Trypan blue solution, 0.4% Thermo Fisher Cat#15250061 Buffer TCL Qiagen Cat#1031576 Critical commercial assays Fixation/permeabilization Concentrate Thermo Fisher Cat#00-5123-43 Fixation/permeabilization Diluent Thermo Fisher Cat#00-5223-56 Cytofix/cytopermTM Fixation and Permeabilization Solution BD Biosciences Cat#554722 Permeabilization Buffer (10X) Thermo Fisher Cat#00-8333-56 GolgiPlugTM Protein Transport Inhibitor BD Biosciences Cat#555029 eBioscienceTM Cell Stimulation Cocktail Thermo Fisher Cat#00-4975-93 SuperScriptTM III One-Step RT-PCR System with PlatinumTM Taq High Fidelity DNA Polymerase Thermo Fisher Cat#12574035 Maxima H Minus Reverse Transcriptase (200 U/μL) Thermo Fisher Cat#EP0753 RNasinTM Plus RNase Inhibitor Promega Cat#N2611 HiFi HS Ready Mix 2X KAPA Biosystems Cat#K2601K EasySep Mouse T cell Isolation Kit Stemcell Technologies Cat#19851 ApopTag Fluorescein In Situ Apoptosis Detection Kit EMD Millipore Cat#S7110 Anti-biotin Microbeads Miltenyi Biotec Cat#130090485 Clarity Western ECL Substrate Bio-Rad Cat#1705061 Clarity Max Western ECL Substrate Bio-Rad Cat#1705062 QIAprep Spin Miniprep Kit (50) Qiagen Cat#27104 QIAquick Gel Extraction Kit (50) Qiagen Cat#28704 Lipofectamine 3000 Transfection Reagent Thermo Fisher Cat#L3000008 Experimental models: Organisms/strains Mouse: C57BL/6J (B6) Jackson Laboratory RRID: IMSR_JAX:000664 (Continued on next page) 20 Cell Reports 45, 117324, May 26, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: B6.Cg-Tg(TcraTcrb)425Cbn/J (OT-II) Mucida Lab (Rockefeller University) RRID: IMSR_JAX:004194 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J (OT-I) Jackson Laboratory RRID: IMSR_JAX:003831 Mouse: B6.SJL-Ptprca Pepcb/BoyJ (CD45.1) Jackson Laboratory RRID: IMSR_JAX:033076 Mouse: B6.129S6(Cg)-Ptf1atm2(cre/ESR1)Cvw/J (Ptf1aCreERT2) Jackson Laboratory RRID: IMSR_JAX:036577 Mouse: B6(Cg)-Ins1tm2.1(cre/ERT2)Thor/J (Ins1CreERT2) Jackson Laboratory RRID: IMSR_JAX:026802 Mouse: B6.Cg-Tg(Vil1-cre/ERT2)23Syr/J (VillinCreERT2) Jackson Laboratory RRID: IMSR_JAX:020282 Mouse: B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J (AlbCre) Jackson Laboratory RRID: IMSR_JAX:003574 Mouse: B6.129S2-Albtm1(cre/ERT2)Mtz/J (AlbCreERT2) Mahan Lab (UT Health Houston) RRID: IMSR_JAX:039060 Mouse: Rosa26-sOVA Zhou et al.7 N/A Mouse: Rosa26-cOVA Zhou et al.7 N/A Mouse: Rosa26-tmOVA Zhou et al.7 N/A Cell line: KPC58 Muir Lab (University of Chicago) N/A Cell line: HEK293T ATCC Cat#CRL-3216 Cell line: L cell, L929 ATCC Cat#CCL-1 Oligonucleotides OVA_F Integrated DNA Technologies CTTCAAAGGACTGTGGGAGAAA OVA_R Integrated DNA Technologies CTCCATCTTCATGCGAGGTAAG pLJM1_sOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTCAGATCC GATGGGCTCCATCGGTGCAG pLJM1_sOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTA CCCGGTAGCGTTACTTGTCATC GTCATCCTTGTAATC pLJM1_cOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTCAGATCCG ATGGGCTCCATCGGCGCAG pLJM1_cOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTACC CGGTAGCGTTACTTGTCATCGTCATCCTTGTAATCG pLJM1_tmOVA_FLAG_F NEBuilder CAGAGCTGGTTTAGTGAACCGTC AGATCCGATGATGGATCAAGCTAGATCAG pLJM1_tmOVA_FLAG_R NEBuilder GATCTGAGTCCGGACTTGTAC CCGGTAGCGTTACTTGTCATCGTCATCCTTG Software and algorithms GraphPad Prism (v10.6.1) GraphPad https://www.graphpad.com/ FlowJo (v10.10.0) Tree Star https://www.flowjo.com/ QuPath (v0.5.1) Bankhead et al.33 https://qupath.github.io/ Adobe Illustrator (v29.0) Adobe www.adobe.com/products/illustrator Devices BD LSRII BD Biosciences N/A 5-laser Aurora spectral flow cytometer Cytek Bioscience N/A EVOSTM FL fluorescent microscope Invitrogen N/A SP8 confocal microscope Leica N/A Cell Reports 45, 117324, May 26, 2026 21 (B6.129S6(Cg)-Ptf1atm2(cre/ESR1)Cvw/J), Ins1CRE-ERT2 (B6(Cg)-Ins1tm2.1(cre/ERT2)Thor/J), OT-I (C57BL/6-Tg(TcraTcrb) 1100Mjb/J), OT-II (B6.Cg-Tg(TcraTcrb)425Cbn/J), AlbCre (B6.Cg-Speer6-ps1Tg(Alb-cre)21 Mgn/J), p53LOXP (B6.129P2-Trp53tm1Brn/J) and KrasFSF−G12D (B6(Cg)-Krastm5Tyj/J) were purchased from The Jackson Laboratory. ..
Virus:Article Title: Prefrontal gamma oscillations engage dynamic cell-type-specific configurations to support flexible behavior.
Article Snippet: .. For experiments REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-GFP primary polyclonal antibody Invitrogen A-11122; RRID: AB_221569 Goat anti-Rabbit IgG (H+L) Alexa Fuor 647 Invitrogen A21245; RRID: AB_2535813 Bacterial and virus strains pAAV-nEF-Coff/Fon-NpHR3.3-EYFP Fenno et al.43 RRID: Addgene_137154 AAV8-nEF-Coff/Fon-NpHR3.3-BFP Virovek N/A AAV1-CAG-DIO-Ace2N-4AA-mNeon Virovek (Plasmid provided by Mark J Schnitzer– Stanford) N/A AAV2/PHP.eB-Ef1a-fDIO-AcemNeon2-WPRE This paper; Provided by Mark J. Schitzer – Stanford N/A AAV2/PHP.eB-Ef1a-DIO-Varnam2-WPRE Haziza et al.30 RRID: Addgene_240055 AAV2/PHP.eB-CAG-cyOFP Haziza et al.30 RRID: Addgene_240050 CAV2-Cre Plateforme de Vectorologie de Montpellier CAV CRE Experimental models: Organisms/strains C57Bl/6J Mice The Jackson Laboratory RRID: IMSR_JAX:000664 Ai14 Mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre Mice The Jackson Laboratory RRID: IMSR_JAX:017320 PV-Flp Mice The Jackson Laboratory RRID: IMSR_JAX:022730 Software and algorithms MATLAB Mathworks RRID: SCR_001622 Graphpad Prism Graphpad RRID: SCR_002798 Synapse – Neurophysiology Suite Tucker-Davis Technologies N/A Video Scoring Software This Paper 10.5281/zenodo.19893431 Behavioral Classification Software This Paper 10.5281/zenodo.19893431 Analysis Software This Paper 10.5281/zenodo.19893431 ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e6, October 21, 2026 combining GEVI expression in PFC-MD neurons with fDIO-NpHR3.0-BFP expression in prefrontal PVI, animals of the PV-Flp (Jax; 022730) line were crossed with Ai14 to generate PV-Flp+/-/Ai14+/- mice enabling expression of Ace-mNeon and TdTomato in PFC-MD neurons and NpHR3.0-BFP in prefrontal PVI (Figure 4). ..
Article Title: Synaptic plasticity of prefrontal long-range inhibition regulates cognitive flexibility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains PV-Cre mice The Jackson Laboratory RRID: IMSR_JAX:008069 Ai14 mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre:Ai14 mice In-house Derived from 008069 and 007914 Bacterial and virus strains AAV5:EF1a:DIO:hChR2(H134R)-EYFPWPRE-pA University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:eNpHR3.0-mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAVrg-CAG-tdTomato Addgene 59462-AAVrg AAVrg-DIO-eYFP Addgene 27056-AAVrg Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (CTb)-Alexa Fluor 594 Invitrogen Cat#C34777 Cholera toxin subunit B (CTb)-Alexa Fluor 488 Invitrogen Cat#C34775 CNQX Tocris Cat#0190 Gabazine Tocris Cat#1262 D-AP5 Tocris Cat#0106 QX-314 bromide Tocris Cat#1014 Software and algorithms pCLAMP 11 Molecular Devices https://www.moleculardevices.com/products/ axon-patch-clamp-system/acquisition-andanalysis-software/pclamp-software-suite Prism 10 GraphPad https://www.graphpad.com SimplyFire 0.6.1 Mori et al.57 N/A Other 10 μL Nanofil syringe World Precision Instruments Cat#NANOFIL Syringe pump World Precision Instruments Cat#UMP3 Vibratome Leica Microsystems VT1200S Digidata 1440A Digitizer Molecular Devices N/A Multiclamp 700A amplifier Molecular Devices N/A Borosilicate glass pipettes Sutter Instruments Cat#FGGBF1007810 IR-DIC microscope (BX51WI) Olympus Cat#BX51WI LED light source Sutter Instrument Lambda FLED 530 LED light source Sutter Instrument Lambda FLED 480 473 nm laser OEM Laser Systems Cat#BL-473-00050-CWM-SD-03-LED-0 594 nm laser (Cobolt 04-01 Series) HÜBNER Photonics N/A Function generator Agilent Cat#33500B Mono fiber-optic implant Doric Lenses Cat#MFC_200/240-0.22_2.0mm_FLT Fiber-optic patch cord Doric Lenses Cat#MFP_200/220/ LWMJ-0.22_2m_FC- FC Small animal food bowls (Nibble Bowls) Pet Smart N/A Light meter ThorLabs Cat#PM100D Metabond Quick Adhesive Cement Parkell Cat#S380 Food pellets (20 mg) Bio-Serv Cat#F0163 (Continued on next page) ll OPEN ACCESS Report e1 Neuron 114, 1–11.e1–e4, October 7, 2026 ..
Plasmid Preparation:Article Title: Prefrontal gamma oscillations engage dynamic cell-type-specific configurations to support flexible behavior.
Article Snippet: .. For experiments REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-GFP primary polyclonal antibody Invitrogen A-11122; RRID: AB_221569 Goat anti-Rabbit IgG (H+L) Alexa Fuor 647 Invitrogen A21245; RRID: AB_2535813 Bacterial and virus strains pAAV-nEF-Coff/Fon-NpHR3.3-EYFP Fenno et al.43 RRID: Addgene_137154 AAV8-nEF-Coff/Fon-NpHR3.3-BFP Virovek N/A AAV1-CAG-DIO-Ace2N-4AA-mNeon Virovek (Plasmid provided by Mark J Schnitzer– Stanford) N/A AAV2/PHP.eB-Ef1a-fDIO-AcemNeon2-WPRE This paper; Provided by Mark J. Schitzer – Stanford N/A AAV2/PHP.eB-Ef1a-DIO-Varnam2-WPRE Haziza et al.30 RRID: Addgene_240055 AAV2/PHP.eB-CAG-cyOFP Haziza et al.30 RRID: Addgene_240050 CAV2-Cre Plateforme de Vectorologie de Montpellier CAV CRE Experimental models: Organisms/strains C57Bl/6J Mice The Jackson Laboratory RRID: IMSR_JAX:000664 Ai14 Mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre Mice The Jackson Laboratory RRID: IMSR_JAX:017320 PV-Flp Mice The Jackson Laboratory RRID: IMSR_JAX:022730 Software and algorithms MATLAB Mathworks RRID: SCR_001622 Graphpad Prism Graphpad RRID: SCR_002798 Synapse – Neurophysiology Suite Tucker-Davis Technologies N/A Video Scoring Software This Paper 10.5281/zenodo.19893431 Behavioral Classification Software This Paper 10.5281/zenodo.19893431 Analysis Software This Paper 10.5281/zenodo.19893431 ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e6, October 21, 2026 combining GEVI expression in PFC-MD neurons with fDIO-NpHR3.0-BFP expression in prefrontal PVI, animals of the PV-Flp (Jax; 022730) line were crossed with Ai14 to generate PV-Flp+/-/Ai14+/- mice enabling expression of Ace-mNeon and TdTomato in PFC-MD neurons and NpHR3.0-BFP in prefrontal PVI (Figure 4). ..
Article Title: Synaptic plasticity of prefrontal long-range inhibition regulates cognitive flexibility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains PV-Cre mice The Jackson Laboratory RRID: IMSR_JAX:008069 Ai14 mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre:Ai14 mice In-house Derived from 008069 and 007914 Bacterial and virus strains AAV5:EF1a:DIO:hChR2(H134R)-EYFPWPRE-pA University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:eNpHR3.0-mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAVrg-CAG-tdTomato Addgene 59462-AAVrg AAVrg-DIO-eYFP Addgene 27056-AAVrg Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (CTb)-Alexa Fluor 594 Invitrogen Cat#C34777 Cholera toxin subunit B (CTb)-Alexa Fluor 488 Invitrogen Cat#C34775 CNQX Tocris Cat#0190 Gabazine Tocris Cat#1262 D-AP5 Tocris Cat#0106 QX-314 bromide Tocris Cat#1014 Software and algorithms pCLAMP 11 Molecular Devices https://www.moleculardevices.com/products/ axon-patch-clamp-system/acquisition-andanalysis-software/pclamp-software-suite Prism 10 GraphPad https://www.graphpad.com SimplyFire 0.6.1 Mori et al.57 N/A Other 10 μL Nanofil syringe World Precision Instruments Cat#NANOFIL Syringe pump World Precision Instruments Cat#UMP3 Vibratome Leica Microsystems VT1200S Digidata 1440A Digitizer Molecular Devices N/A Multiclamp 700A amplifier Molecular Devices N/A Borosilicate glass pipettes Sutter Instruments Cat#FGGBF1007810 IR-DIC microscope (BX51WI) Olympus Cat#BX51WI LED light source Sutter Instrument Lambda FLED 530 LED light source Sutter Instrument Lambda FLED 480 473 nm laser OEM Laser Systems Cat#BL-473-00050-CWM-SD-03-LED-0 594 nm laser (Cobolt 04-01 Series) HÜBNER Photonics N/A Function generator Agilent Cat#33500B Mono fiber-optic implant Doric Lenses Cat#MFC_200/240-0.22_2.0mm_FLT Fiber-optic patch cord Doric Lenses Cat#MFP_200/220/ LWMJ-0.22_2m_FC- FC Small animal food bowls (Nibble Bowls) Pet Smart N/A Light meter ThorLabs Cat#PM100D Metabond Quick Adhesive Cement Parkell Cat#S380 Food pellets (20 mg) Bio-Serv Cat#F0163 (Continued on next page) ll OPEN ACCESS Report e1 Neuron 114, 1–11.e1–e4, October 7, 2026 ..
Expressing:Article Title: Prefrontal gamma oscillations engage dynamic cell-type-specific configurations to support flexible behavior.
Article Snippet: .. For experiments REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-GFP primary polyclonal antibody Invitrogen A-11122; RRID: AB_221569 Goat anti-Rabbit IgG (H+L) Alexa Fuor 647 Invitrogen A21245; RRID: AB_2535813 Bacterial and virus strains pAAV-nEF-Coff/Fon-NpHR3.3-EYFP Fenno et al.43 RRID: Addgene_137154 AAV8-nEF-Coff/Fon-NpHR3.3-BFP Virovek N/A AAV1-CAG-DIO-Ace2N-4AA-mNeon Virovek (Plasmid provided by Mark J Schnitzer– Stanford) N/A AAV2/PHP.eB-Ef1a-fDIO-AcemNeon2-WPRE This paper; Provided by Mark J. Schitzer – Stanford N/A AAV2/PHP.eB-Ef1a-DIO-Varnam2-WPRE Haziza et al.30 RRID: Addgene_240055 AAV2/PHP.eB-CAG-cyOFP Haziza et al.30 RRID: Addgene_240050 CAV2-Cre Plateforme de Vectorologie de Montpellier CAV CRE Experimental models: Organisms/strains C57Bl/6J Mice The Jackson Laboratory RRID: IMSR_JAX:000664 Ai14 Mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre Mice The Jackson Laboratory RRID: IMSR_JAX:017320 PV-Flp Mice The Jackson Laboratory RRID: IMSR_JAX:022730 Software and algorithms MATLAB Mathworks RRID: SCR_001622 Graphpad Prism Graphpad RRID: SCR_002798 Synapse – Neurophysiology Suite Tucker-Davis Technologies N/A Video Scoring Software This Paper 10.5281/zenodo.19893431 Behavioral Classification Software This Paper 10.5281/zenodo.19893431 Analysis Software This Paper 10.5281/zenodo.19893431 ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e6, October 21, 2026 combining GEVI expression in PFC-MD neurons with fDIO-NpHR3.0-BFP expression in prefrontal PVI, animals of the PV-Flp (Jax; 022730) line were crossed with Ai14 to generate PV-Flp+/-/Ai14+/- mice enabling expression of Ace-mNeon and TdTomato in PFC-MD neurons and NpHR3.0-BFP in prefrontal PVI (Figure 4). ..
Derivative Assay:Article Title: Synaptic plasticity of prefrontal long-range inhibition regulates cognitive flexibility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains PV-Cre mice The Jackson Laboratory RRID: IMSR_JAX:008069 Ai14 mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre:Ai14 mice In-house Derived from 008069 and 007914 Bacterial and virus strains AAV5:EF1a:DIO:hChR2(H134R)-EYFPWPRE-pA University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:eNpHR3.0-mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAVrg-CAG-tdTomato Addgene 59462-AAVrg AAVrg-DIO-eYFP Addgene 27056-AAVrg Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (CTb)-Alexa Fluor 594 Invitrogen Cat#C34777 Cholera toxin subunit B (CTb)-Alexa Fluor 488 Invitrogen Cat#C34775 CNQX Tocris Cat#0190 Gabazine Tocris Cat#1262 D-AP5 Tocris Cat#0106 QX-314 bromide Tocris Cat#1014 Software and algorithms pCLAMP 11 Molecular Devices https://www.moleculardevices.com/products/ axon-patch-clamp-system/acquisition-andanalysis-software/pclamp-software-suite Prism 10 GraphPad https://www.graphpad.com SimplyFire 0.6.1 Mori et al.57 N/A Other 10 μL Nanofil syringe World Precision Instruments Cat#NANOFIL Syringe pump World Precision Instruments Cat#UMP3 Vibratome Leica Microsystems VT1200S Digidata 1440A Digitizer Molecular Devices N/A Multiclamp 700A amplifier Molecular Devices N/A Borosilicate glass pipettes Sutter Instruments Cat#FGGBF1007810 IR-DIC microscope (BX51WI) Olympus Cat#BX51WI LED light source Sutter Instrument Lambda FLED 530 LED light source Sutter Instrument Lambda FLED 480 473 nm laser OEM Laser Systems Cat#BL-473-00050-CWM-SD-03-LED-0 594 nm laser (Cobolt 04-01 Series) HÜBNER Photonics N/A Function generator Agilent Cat#33500B Mono fiber-optic implant Doric Lenses Cat#MFC_200/240-0.22_2.0mm_FLT Fiber-optic patch cord Doric Lenses Cat#MFP_200/220/ LWMJ-0.22_2m_FC- FC Small animal food bowls (Nibble Bowls) Pet Smart N/A Light meter ThorLabs Cat#PM100D Metabond Quick Adhesive Cement Parkell Cat#S380 Food pellets (20 mg) Bio-Serv Cat#F0163 (Continued on next page) ll OPEN ACCESS Report e1 Neuron 114, 1–11.e1–e4, October 7, 2026 ..
Recombinant:Article Title: Synaptic plasticity of prefrontal long-range inhibition regulates cognitive flexibility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains PV-Cre mice The Jackson Laboratory RRID: IMSR_JAX:008069 Ai14 mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre:Ai14 mice In-house Derived from 008069 and 007914 Bacterial and virus strains AAV5:EF1a:DIO:hChR2(H134R)-EYFPWPRE-pA University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:eNpHR3.0-mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAVrg-CAG-tdTomato Addgene 59462-AAVrg AAVrg-DIO-eYFP Addgene 27056-AAVrg Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (CTb)-Alexa Fluor 594 Invitrogen Cat#C34777 Cholera toxin subunit B (CTb)-Alexa Fluor 488 Invitrogen Cat#C34775 CNQX Tocris Cat#0190 Gabazine Tocris Cat#1262 D-AP5 Tocris Cat#0106 QX-314 bromide Tocris Cat#1014 Software and algorithms pCLAMP 11 Molecular Devices https://www.moleculardevices.com/products/ axon-patch-clamp-system/acquisition-andanalysis-software/pclamp-software-suite Prism 10 GraphPad https://www.graphpad.com SimplyFire 0.6.1 Mori et al.57 N/A Other 10 μL Nanofil syringe World Precision Instruments Cat#NANOFIL Syringe pump World Precision Instruments Cat#UMP3 Vibratome Leica Microsystems VT1200S Digidata 1440A Digitizer Molecular Devices N/A Multiclamp 700A amplifier Molecular Devices N/A Borosilicate glass pipettes Sutter Instruments Cat#FGGBF1007810 IR-DIC microscope (BX51WI) Olympus Cat#BX51WI LED light source Sutter Instrument Lambda FLED 530 LED light source Sutter Instrument Lambda FLED 480 473 nm laser OEM Laser Systems Cat#BL-473-00050-CWM-SD-03-LED-0 594 nm laser (Cobolt 04-01 Series) HÜBNER Photonics N/A Function generator Agilent Cat#33500B Mono fiber-optic implant Doric Lenses Cat#MFC_200/240-0.22_2.0mm_FLT Fiber-optic patch cord Doric Lenses Cat#MFP_200/220/ LWMJ-0.22_2m_FC- FC Small animal food bowls (Nibble Bowls) Pet Smart N/A Light meter ThorLabs Cat#PM100D Metabond Quick Adhesive Cement Parkell Cat#S380 Food pellets (20 mg) Bio-Serv Cat#F0163 (Continued on next page) ll OPEN ACCESS Report e1 Neuron 114, 1–11.e1–e4, October 7, 2026 ..
Adhesive:Article Title: Synaptic plasticity of prefrontal long-range inhibition regulates cognitive flexibility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains PV-Cre mice The Jackson Laboratory RRID: IMSR_JAX:008069 Ai14 mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre:Ai14 mice In-house Derived from 008069 and 007914 Bacterial and virus strains AAV5:EF1a:DIO:hChR2(H134R)-EYFPWPRE-pA University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:eNpHR3.0-mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAVrg-CAG-tdTomato Addgene 59462-AAVrg AAVrg-DIO-eYFP Addgene 27056-AAVrg Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (CTb)-Alexa Fluor 594 Invitrogen Cat#C34777 Cholera toxin subunit B (CTb)-Alexa Fluor 488 Invitrogen Cat#C34775 CNQX Tocris Cat#0190 Gabazine Tocris Cat#1262 D-AP5 Tocris Cat#0106 QX-314 bromide Tocris Cat#1014 Software and algorithms pCLAMP 11 Molecular Devices https://www.moleculardevices.com/products/ axon-patch-clamp-system/acquisition-andanalysis-software/pclamp-software-suite Prism 10 GraphPad https://www.graphpad.com SimplyFire 0.6.1 Mori et al.57 N/A Other 10 μL Nanofil syringe World Precision Instruments Cat#NANOFIL Syringe pump World Precision Instruments Cat#UMP3 Vibratome Leica Microsystems VT1200S Digidata 1440A Digitizer Molecular Devices N/A Multiclamp 700A amplifier Molecular Devices N/A Borosilicate glass pipettes Sutter Instruments Cat#FGGBF1007810 IR-DIC microscope (BX51WI) Olympus Cat#BX51WI LED light source Sutter Instrument Lambda FLED 530 LED light source Sutter Instrument Lambda FLED 480 473 nm laser OEM Laser Systems Cat#BL-473-00050-CWM-SD-03-LED-0 594 nm laser (Cobolt 04-01 Series) HÜBNER Photonics N/A Function generator Agilent Cat#33500B Mono fiber-optic implant Doric Lenses Cat#MFC_200/240-0.22_2.0mm_FLT Fiber-optic patch cord Doric Lenses Cat#MFP_200/220/ LWMJ-0.22_2m_FC- FC Small animal food bowls (Nibble Bowls) Pet Smart N/A Light meter ThorLabs Cat#PM100D Metabond Quick Adhesive Cement Parkell Cat#S380 Food pellets (20 mg) Bio-Serv Cat#F0163 (Continued on next page) ll OPEN ACCESS Report e1 Neuron 114, 1–11.e1–e4, October 7, 2026 ..
Food & Beverages:Article Title: Synaptic plasticity of prefrontal long-range inhibition regulates cognitive flexibility.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains PV-Cre mice The Jackson Laboratory RRID: IMSR_JAX:008069 Ai14 mice The Jackson Laboratory RRID: IMSR_JAX:007914 PV-Cre:Ai14 mice In-house Derived from 008069 and 007914 Bacterial and virus strains AAV5:EF1a:DIO:hChR2(H134R)-EYFPWPRE-pA University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:eNpHR3.0-mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAV5:EF1a:DIO:mCherry University of North Carolina Vector Core, Chapel Hill, NC, USA In-stock vector (Dr. Karl Deisseroth) AAVrg-CAG-tdTomato Addgene 59462-AAVrg AAVrg-DIO-eYFP Addgene 27056-AAVrg Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (CTb)-Alexa Fluor 594 Invitrogen Cat#C34777 Cholera toxin subunit B (CTb)-Alexa Fluor 488 Invitrogen Cat#C34775 CNQX Tocris Cat#0190 Gabazine Tocris Cat#1262 D-AP5 Tocris Cat#0106 QX-314 bromide Tocris Cat#1014 Software and algorithms pCLAMP 11 Molecular Devices https://www.moleculardevices.com/products/ axon-patch-clamp-system/acquisition-andanalysis-software/pclamp-software-suite Prism 10 GraphPad https://www.graphpad.com SimplyFire 0.6.1 Mori et al.57 N/A Other 10 μL Nanofil syringe World Precision Instruments Cat#NANOFIL Syringe pump World Precision Instruments Cat#UMP3 Vibratome Leica Microsystems VT1200S Digidata 1440A Digitizer Molecular Devices N/A Multiclamp 700A amplifier Molecular Devices N/A Borosilicate glass pipettes Sutter Instruments Cat#FGGBF1007810 IR-DIC microscope (BX51WI) Olympus Cat#BX51WI LED light source Sutter Instrument Lambda FLED 530 LED light source Sutter Instrument Lambda FLED 480 473 nm laser OEM Laser Systems Cat#BL-473-00050-CWM-SD-03-LED-0 594 nm laser (Cobolt 04-01 Series) HÜBNER Photonics N/A Function generator Agilent Cat#33500B Mono fiber-optic implant Doric Lenses Cat#MFC_200/240-0.22_2.0mm_FLT Fiber-optic patch cord Doric Lenses Cat#MFP_200/220/ LWMJ-0.22_2m_FC- FC Small animal food bowls (Nibble Bowls) Pet Smart N/A Light meter ThorLabs Cat#PM100D Metabond Quick Adhesive Cement Parkell Cat#S380 Food pellets (20 mg) Bio-Serv Cat#F0163 (Continued on next page) ll OPEN ACCESS Report e1 Neuron 114, 1–11.e1–e4, October 7, 2026 ..
|
